Ophryotrocha platykephale

Ophryotrocha platykephale vertical
Ophryotrocha platykephale

 

 

 

 

 

 

 

 

 

S21859 CO1 sequence:
TGGTCAACAAATCATAAAGATATTGGTACTTTATATTTATTATTTGGTGTATGAAGAGGCCTATTAGGATCAGCAATAAGACTTTTAATTCGAGTTGAATTAGGACAACCTGGAGCTTTCTTTGGTAATGACCAACTCTATAATTCACTTGTAACTGCTCATGGTTTTCTAATAATTTTCTTTATAGTGATACCAATGGCTATTGGTGGATTTGGTAACTGATTAGTTCCTTTAATATTAAACGCCCCAGATATAGCTTTCCCTCGTCTTAATAATATAAGATTTTGATTATTACCACCCGCTTTAACCCTTCTTACTATATCAGCTATAATTGAAAACGGTTCAGGAACAGGGTGAACTGTATACCCTCCTTTATCAAGAAATCTTTCTCATAGAGGGGCTTCTGTAGATCTATGTATTTTCTCTCTTCATTTAGCCGGAATCAGATCTATTTTAGGAGCTTTAAATTTTATTACCACTGTTATTAATATACGTTCTCATACTATACGACTTGAACGAGTCCCTCTATTCGTTTGATCTGTTCAAATTACCGCTGTATTATTACTTTTATCTTTACCTGTCCTAGCAGGAGCCTTAACAATGCTACTCACTGATCGAAATCT-AAACACCTCA

The holotype for Ophryotrocha platykephale was originally collected and described from the East Pacific Rise up the Gulf of California (Blake 1985). Greg Rouse collected this specimen on the 2013 cruise. However, this identification was solely based on morphology, because there is currently no GenBank COI sequence available for this species.

Blake, J.A., & Hilbig, B. (1985). Polychaeta from the vicinity of deep-sea geothermal vents in the eastern Pacific. I: Euphrosinidae, Phyllodocidae, Hesionidae, Nereididae, Glyceridae, Dorvilleidae, Orbiniidae and Maldanidae. Bulletin of the Biological Society of Washington, 6, 67-101.

Leave a Reply

(*) Required, Your email will not be published