Paralomis multispina

Paralomis multispina

 

 

 

 

 

 

S22112 COI sequence:
TATTGGTACAWTATATTTTATTTTTGGAGCTTGAGCTGGGATAGTGGGAACTTCTTTGAGTTTAATTATTCGAGCTGAACTAGGCCAACCAGGCAGTTTGATTGGAGATGACCAAATTTATAATGTAGTTGTTACAGCACATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGCTTTGGAAATTGACTAGTGCCACTAATGTTAGGAGCACCAGATATGGCCTTTCCGCGAATAAATAATATAAGTTTTTGACTTTTACCTCCATCTTTAACTCTTTTATTGACCAGTGGTATAGTAGAAAGAGGTGTAGGAACAGGGTGAACTGTTTACCCGCCGCTGTCCGCGGCAATTGCTCACGCGGGAGCATCAGTGGACTTGGGTATTTTTTCTTTACACTTAGCCGGAGTATCTTCTATTTTAGGAGCTGTAAATTTTATAACCACAGTTATTAATATACGCCCTCAAGGAATAACTTTAGATCGTATACCTTTGTTTGTGTGGTCAGTATTTATTACGGCAATTTTACTCTTATTATCATTGCCAGTTTTAGCCGGAGCAATTACTATGTTACTTACAGATCGAAACTTAAACACCTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCAGTGCTATACCAGCATTTATTTTGATTTTTTGGTCA

Paralomis multispina is known from Alaska to San Diego, California, USA and off the Pacific coast of Japan (Sakai, 1971; Wicksten, 1989; Hendrickx & Harvey, 1999). The carapace is pyriform and thickly covered with sharp spines. Apical parts of spines on carapace usually look like to be cut off, forming round or elliptical faces (Sakai, 1971). Paralomis multispina is not specific to chemosynthetic communities, but large populations are frequently observed around cold seeps in Sagami Bay or hydrothermal vent fields in Hatoma Knoll and Iheya Ridge, Okinawa Trough (Ohta & Kim, 2001; Martin & Haney, 2005).

http://www.marinespecies.org/aphia.php?p=taxdetails&id=378131

Martin, J.W.; Haney, T.A. (2005). Decapod crustaceans from hydrothermal vents and cold seeps: a review through 2005. Zoological Journal of the Linnean Society, 145: 445-522.

http://www.godac.jamstec.go.jp/bismal/e/view/9000066

Leave a Reply

(*) Required, Your email will not be published