Peinaleopolynoe santacatalina

Peinaleopolynoe santacatalina

 

 

 

 

 

 

S21747_ROSE CO1 sequence:
GCTCTACTAGGCAGAGACCAACTTTATAATACTGTAGTAACCGCTCATGCTTTCCTAATAATTTTCTTTCTAGTAATACCTGTACTAGTTGGAGGTTTTGGTAATTGACTTGTTCCTTTAATACTAGGGGCTCCAGATATAGCTTTCCCCCGTCTTAATAATATAAGATTTTGACTTCTCCCCCCTTCCCTAATTTTACTTTTATCTTCAAGAGCAGTAGAAAAGGGGGCAGGAACAGGGTGAACAGTTTACCCTCCATTAGCCAGAAACATTGCACATGCTGGCCCATCAGTTGACCTCGCTATTTTTTCACTACATATTGCAGGTGCATCTTCTATTCTTGCTGCATTAAATATTATAACAACAGTTATTAATATACGTTATAAAGGTCTTCGATTAGAACGAGTCCCTTTATTTGTGTGATCTATTTTTATTACTGTAATTCTTCTTCTATTATCTCTTCCAGTATTAGCCGGGGCTATTACTATACTTCTAACTGACCGTAATCTTAATACAGCCTTTTTTGATCC

Marian Pettibone collected and described the Peinaleopolynoe santacatalina holotype from the bathyal region of the Santa Catalina Basin, “on or within 0.5m of the [whale] bones” (Pettibone 1993); Greg Rouse collected this specimen on the 2013 cruise. Our Maximum Likelihood phylogenetic analysis includes the Peinaleopolynoe gene sequences (COI, 16S, 18S, & 28S) we obtained, as well as the Norlinder 2012 sequences retrieved from GenBank. The resulting phylogenetic tree places our P. santacatalina specimen sister group to two new Peinaleopolynoe species, as well as P. sillardi. Morphology of the specimens within the Peinaleopolynoe clade corresponds to either the original or revised genus description (Pettibone 1993).

Norlinder, E., Nygren, A., Wiklund, H., & Pleijel, F. (2012). Phylogeny of scale-worms (Aphroditiformia, Annelida), assessed from 18SrRNA, 28SrRNA, 16SrRNA, mitochondrial cytochrome c oxidase subunit I (COI), and morphology. Molecular Phylogenetics & Evolution, 65(2), 490-500.
Link: http://www.sciencedirect.com/science/article/pii/S105579031200259X

Pettibone, M. (1993). Polynoid Polychaetes Associated with a Whale Skeleton in the Bathyal Santa Catalina Basin. Proceedings of the Biological Society of Washington, 106(4), 678-688.
Link: https://repository.si.edu/bitstream/handle/10088/3390/Pettibone-1993-678.pdf?sequence=1&isAllowed=y

Leave a Reply

(*) Required, Your email will not be published